The Journal of General Physiology
Avanti Polar Lipids
  Home | Help | Feedback | Subscriptions | Archive | Search | Table of Contents

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF, 351K)
Right arrow PPT slides of all figures
Right arrow Alert me when this article is cited
Right arrow Citation Map
Services
Right arrow Email this article
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new content in the JGP
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by McNicholas, C. M.
Right arrow Articles by Canessa, C. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by McNicholas, C. M.
Right arrow Articles by Canessa, C. M.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?
J. Gen. Physiol.
© The Rockefeller University Press
0022-1295/97/06/681/12 $2.00
Volume 109, Number 6, June 1997 681-692

Diversity of Channels Generated by Different Combinations of Epithelial Sodium Channel Subunits

Carmel M. McNicholas and Cecilia M. Canessa

From the Department of Cellular and Molecular Physiology, Yale University School of Medicine, New Haven, Connecticut 06520-8026

ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES


ABSTRACT

The epithelial sodium channel is a multimeric protein formed by three homologous subunits: alpha , beta , and gamma ; each subunit contains only two transmembrane domains. The level of expression of each of the subunits is markedly different in various Na+ absorbing epithelia raising the possibility that channels with different subunit composition can function in vivo. We have examined the functional properties of channels formed by the association of alpha  with beta  and of alpha  with gamma  in the Xenopus oocyte expression system using two-microelectrode voltage clamp and patch-clamp techniques. We found that alpha beta channels differ from alpha gamma channels in the following functional properties: (a) alpha beta channels expressed larger Na+ than Li+ currents (INa+/ILi+ 1.2) whereas alpha gamma channels expressed smaller Na+ than Li+ currents (INa+/ILi+ 0.55); (b) the Michaelis Menten constants (Km) of activation of current by increasing concentrations of external Na+ and Li+ of alpha beta channels were larger (Km > 180 mM) than those of alpha gamma channels (Km of 35 and 50 mM, respectively); (c) single channel conductances of alpha beta channels (5.1 pS for Na+ and 4.2 pS for Li+) were smaller than those of alpha gamma channels (6.5 pS for Na+ and 10.8 pS for Li+); (d) the half-inhibition constant (Ki) of amiloride was 20-fold larger for alpha beta channels than for alpha gamma channels whereas the Ki of guanidinium was equal for both alpha beta and alpha gamma . To identify the domains in the channel subunits involved in amiloride binding, we constructed several chimeras that contained the amino terminus of the gamma  subunit and the carboxy terminus of the beta  subunit. A stretch of 15 amino acids, immediately before the second transmembrane domain of the beta  subunit, was identified as the domain conferring lower amiloride affinity to the alpha beta channels. We provide evidence for the existence of two distinct binding sites for the amiloride molecule: one for the guanidium moiety and another for the pyrazine ring. At least two subunits alpha  with beta  or gamma  contribute to these binding sites. Finally, we show that the most likely stoichiometry of alpha beta and alpha gamma channels is 1alpha :1beta and 1alpha :1gamma , respectively.

Key words: epithelial Na+ channel;  amiloride;  guanidinium;  Xenopus oocyte

INTRODUCTION

Epithelial sodium channels (ENaC)1 mediate sodium reabsorption in a variety of tissues (for review, see Garty and Benos, 1988; Rossier et al., 1994). Na+ channels are located in the apical membranes of epithelia such as the distal nephron and colon, the ducts of salivary and sweat glands, and the respiratory tract. Molecular cloning of ENaC has revealed that the channel is formed by three homologous subunits, alpha , beta , and gamma  (Canessa et al., 1994), that share 34-37% identity at the amino acid level. Expression of the three subunits in a heterologous system such as Xenopus oocytes reconstitutes channels with properties similar to those present in native tissues: high selectivity of sodium over potassium (PNa+/PK+ > 20), half-inhibition constant (Ki) of amiloride of 0.10 µM, and only a slight voltage dependence of the open probability (Hamilton and Eaton, 1985; Palmer and Frindt, 1986; Canessa et al., 1994). Canessa et al. (1994) have previously shown that co- expression of alpha , beta , and gamma  subunits is necessary to induce maximal levels of channel activity. Single subunits produce amiloride-sensitive currents of small magnitude (alpha  subunit expressed alone induces only 1% of the maximal whole-cell current) or no current at all (beta  or gamma  expressed alone or co-expression of the two subunits do not induce any current). However, co-expression of alpha  and beta  subunits or of alpha  and gamma  subunits results in about 15-20% of the maximal magnitude of amiloride-sensitive whole cell current.

The total number of subunits and the stoichiometry of the subunits in ENaC have not yet been determined. Additionally, it is not known whether the subunit composition can be varied to give channels with different functional properties. The physiological relevance of channels of different subunit composition is supported by the observation that not all Na+ absorbing epithelia express the three subunits of ENaC. In the lung there is a heterogeneity of expression with some cells having only alpha  and gamma  subunits (Farman et al., 1997); in colonic epithelia, in the absence of stimulation by aldosterone, only the alpha  subunit is expressed (Lingueglia et al., 1994; Asher et al., 1997). These findings raise the possibility that, at least in certain tissues, only one or two ENaC subunits may be sufficient to form functional sodium channels in vivo.

Because little is known about the properties of channels that consist of only two of the ENaC subunits, we describe the expression and functional properties of channels formed by the combination of alpha  and beta  and of alpha  and gamma  subunits. We found that alpha beta and alpha gamma channels differ in sensitivity to the blocker amiloride, Km values for activation by external Na+ and Li+, and single channel conductances. Maximal currents were observed when the cRNAs injected of alpha  and beta , and alpha  and gamma  were of 1:1 ratio; large variations from this ratio decreased the magnitude of the amiloride-sensitive currents, but the distinct functional properties of the alpha beta and alpha gamma channels were maintained suggesting that the most likely stoichiometry of alpha beta and alpha gamma channels is 1alpha :1beta and 1alpha :1gamma , respectively. In addition, we identified a short stretch of amino acids before the second transmembrane domain that determines amiloride affinity. We discuss a model that describes the presence of at least two distinct binding sites for the amiloride molecule, one site for the guanidinium moiety and another for the pyrazine ring.


METHODS

Expression of Sodium Channels in Oocytes

cDNAs were propagated in the transcription-competent vector pSD-5 in Escherichia coli DH5alpha . Capped cRNAs were transcribed in vitro from linearized cDNAs using SP6 RNA polymerase. Stage V-VI Xenopus oocytes were isolated by partial ovariectomy under tricaine anesthesia and then defolliculated by treatment with 1 mg/ml collagenase (Type 1A; Sigma Chemical Co., St. Louis, MO) in zero Ca2+ modified Barth's solution (MBS), containing in mmol/liter: 85 NaCl, 2.4 NaHCO3, 1 KCl, 0.8 MgSO4, 0.3 Ca(NO3), 0.4 CaCl2, and 5 HEPES (buffered to pH 7.2) for 1 h at room temperature. 2-24 h after defolliculation, oocytes were injected with 1-3 ng of each cRNA in a final volume of 50 nl. The amount of injected cRNA was changed to obtain five conditions with different ratios of alpha  and beta , or of alpha  and gamma  cRNAs. Condition 10alpha :1beta received 3 ng of alpha  and 0.3 ng of beta ; condition 5alpha :1beta received 3 ng of alpha  and 0.6 ng of beta ; condition 1alpha :1beta received 3 ng each of alpha  and beta ; condition 1alpha :5beta received 0.6 ng of alpha  and 3 ng of beta , and condition 1alpha :10beta received 0.3 ng of alpha  and 3 ng of beta . Similar experimental protocols were used for the five corresponding alpha gamma conditions. In experiments where the beta alpha -dimer was injected, oocytes received 1 ng of beta alpha -dimer cRNA alone or in addition to 1, 2, or 3 ng of alpha  cRNA or 1, 2, or 3 ng of beta  cRNA. In experiments where the alpha gamma -dimer was injected, oocytes received 1 ng of alpha gamma -dimer cRNA alone or in addition to 1, 2, or 3 ng of alpha  cRNA or 1, 2, or 3 ng of gamma  cRNA. Oocytes were kept in MBS with 1.8 mM Ca2+, supplemented with penicillin (100 U/ml) and streptomycin (100 µg/ml) for 3-5 d at 19°C before experiments.

Electrophysiology

Oocyte whole-cell currents were measured using the two-microelectrode voltage clamp technique (Oocyte Clamp C-725B; Warner Instrument Corp., Hamden, CT). Epithelial sodium channel currents were calculated as the difference in whole-cell current before and after the addition of 100 µM amiloride to the bathing solution. The bath solution contained in mmol/liter: 1.8 CaCl2; 2 MgCl2; 4 KCl; 5 BaCl2; 5 HEPES, buffered to pH 7.2, and 0-150 mM Na+, Li+, or K+ gluconate. NMDG-gluconate (N -methyl- D-glucamine) was used to make the total concentration of cation-gluconate 150 mM. Pulse software (HEKA Elektronik, Lambrecht, Germany) was used to generate voltage pulses. To obtain I-V curves, the membrane potential was changed from -180 to 80 mV by 20-mV incremental steps of 200-ms duration. Data were collected and analyzed with a Power Macintosh computer.

The Kms for external Na+ and Li+ were calculated from the amiloride-sensitive component of whole-cell currents (I) induced by varying the concentration (C) of Na+ or Li+ in the bath solution from 0 to 150 mM. The data were fitted to the Michaelis-Menten equation:
I=I<SUB>max</SUB>(C/K<SUB>m</SUB>+C), (1)

where Imax is the maximal current and Km is the half-activation constant using a nonlinear fit program based on the simplex method.

Dose-response curves for the blockers amiloride, benzamil, and guanidinium were obtained by measuring the change in current induced by adding increasing concentrations of blocker into the bath solution. The data were fitted to the equation:
I=I<SUB>max</SUB>− [I<SUB>max</SUB>/(1+A/K<SUB>i</SUB>)], (2)

where A is the concentration of the blocker and Ki is the inhibition constant. To assess the voltage dependence of amiloride block, the Ki was measured at various membrane holding potentials ranging from -180 to 50 mV. As indicated, in certain experiments the Ki of amiloride was measured in the presence of 150 or 30 mM Na+ in the bathing solution. Results are expressed as mean ± standard error (SEM), n = number of observations.

Patch Clamp Technique

Single channel recordings were obtained from membrane patches from Xenopus oocytes (Methfessel et al., 1986) injected with either (alpha , beta , and gamma ), (alpha  and gamma ), or (alpha  and beta ) rat ENaC cRNAs. Recording pipettes were constructed from borosilicate glass capillaries (Dagan Corp., Minneapolis, MN) using a Narishige PP83 microelectrode puller (Narishige Scientific Instrument Laboratory, Tokyo, Japan) and were not fire polished. The pipettes had tip resistances of 2-5 MOmega and were partially filled with solutions containing, in mmol/liter: 150 NaCl or LiCl; 1 CaCl2; 1 MgCl2; 5 HEPES, buffered to a final pH of 7.4. Bath solutions contained, in mmol/liter: 150 NaCl or LiCl; 5 EDTA; 5 HEPES, buffered to a final pH of 7.4. Experiments were performed at room temperature (~20-22°C).

Single channel currents were recorded from cell-attached patches with a patch clamp amplifier (Model EPC-7; List Electronics, Darmstadt, Germany, or Model PC-505; Warner Instrument Corp.). The signal was low pass filtered at 500 Hz with an 8-pole bessel filter and stored on video tape after pulse code modulation (Model PCM-501ES; Sony, Tokyo, Japan). For analysis, data were re-digitized (2 kHz), transferred to a PC, and analyzed using the pCLAMP6 (Axon Instruments Inc., Burlingame, CA) software system. Data were then filtered at 30-100 Hz for analysis and display. Single channel conductance was estimated with linear regression analysis from currents measured from -100 and -40 mV.

Construction of cDNAs

Chimeras of gamma  and beta  rat ENaC cDNAs were generated by a two-step PCR protocol. CH1 was constructed by amplification of wild-type gamma  template using a complementary sense primer 5'CATCTACAACGCTGCC3' and an antisense gamma -beta hybrid primer 5'CCGCCTCCTGCGGGCGATGATAGAGAAG3'. The gamma -beta hybrid antisense primer has the 3' half of the sequence complementary to gamma  and the 5' half complementary to beta  sequences. The amplification protocol consisted of 20 cycles of 94°C for 45 s, 60°C for 45 s, and 72°C for 45 s. 1 µl of the first PCR product was mixed with wild-type beta  template for the second PCR amplification, the sense primer of the first PCR reaction, and an antisense primer complementary to beta  5'AATATTCTGGTACCAGC3'. The amplification protocol consisted of 25 cycles of 94°C for 45 s, 55°C for 50 s, and 72°C for 50 s. CH2 was constructed by amplification of gamma  template with a complementary sense primer 5'CATCTACAACGCTGCC3' and an antisense gamma -beta hybrid 5'GATCTCCCCAAACTCAATGACACAGACGAC3'. 1 µl of the first PCR reaction was mixed with beta  template in a second amplification that contained the sense primer of the first reaction and a specific antisense beta  primer 5'AATATTCTGGTACCAGC3'. CH3 was constructed by amplification of gamma  template using a complementary sense primer 5'CATCTACAACGCTGCC3' and an antisense gamma -beta hybrid primer 5'GGCCACCCAGGTTGGACAGGAGCATCTC3'. The second PCR amplification used the first PCR sense primer and an antisense primer complementary to beta  5'AATATTCTGGTACCAGC3'. For the first PCR of CH4 a sense gamma primer 5'CATCTACAACGCTGCC3' with an antisense gamma -beta hybrid primer 5'GATATTTGAGCTCTGGTCCCAGGTGAGAACATT3' were used to amplify gamma  template. The second amplification used beta  template, the same sense primer and an antisense beta  primer 5'CATCTACAACGCTGCC3'. The products of all the second PCR reactions were digested with two unique restriction enzymes BglII and KpnI, and subcloned into the vector pSD5.

Construction of alpha  and beta  dimers was performed in the following way: The coding regions of the cDNAs of alpha  and beta  subunits were linked to form a single polypeptide by the addition of a unique ClaI site after the last amino acid of the beta  subunit and before the first methionine of the alpha  subunit using PCR. The alpha  and beta  cDNAs were digested with ClaI and ligated into a single cDNA that encodes for the beta alpha polypeptide. Construction of alpha  and gamma  dimer was performed by the addition of a ClaI site at the end of the coding region of the gamma  cDNA and immediately before the first methionine of the alpha  subunit using PCR. The alpha  and gamma  cDNAs were digested with ClaI and ligated into a single cDNA that encodes for one gamma alpha polypeptide. The presence of the ClaI site introduced two amino acids (isoleucine and aspartic acid) between beta  and alpha  subunits and between gamma  and alpha  subunits.

All constructs were sequenced at the Yale facility using an ABI 373 automated DNA sequencer employing dye terminators following a standard protocol supplied by the manufacturer (Applied Biosystems, Inc., Foster City, CA).


RESULTS

Na+ and Li+ Selectivity of Channels with Different Subunit Composition

The native epithelial sodium channel has high selectivity for Na+ over other cations. The only other permeant ions are Li+ (with a PLi+/PNa+ 1.5) and H+ ions (Palmer, 1984). We examined the relative permeabilities for Na+ and Li+ of the amiloride-sensitive current in oocytes co-injected with equal amounts of alpha  and beta  or of alpha  and gamma  cRNAs. The magnitude of the observed amiloride-sensitive sodium current varied from 0.2 to 3 µA, a level of expression adequate for our whole-cell studies. The mean currents were 1.9 ± 0.7 µA for alpha beta and 2.7 ± 0.9 µA for alpha gamma . Current-voltage relations were generated in the presence of 150 mM K+, Na+ or Li+ as the gluconate salt in the bathing solution. Membrane potentials were changed in 20 mV incremental steps from -180 to 80 mV. Fig. 1 A shows the relative currents of Na+, Li+, and K+ for alpha gamma channels. Current measurements have been normalized to the amiloride-sensitive Na+ current obtained at -100 mV. At this potential and with this combination of subunits the inward Li+ current was 1.5-fold greater than the Na+ current. There was no significant inward current when the bath contained 150 mM K+. The small outward current at depolarizing membrane potentials is probably carried by Na+ because it is substantially reduced by exposing the cells to Na+ free solutions for 24 h (not shown). Fig. 1 B shows the results of the relative currents through alpha beta channels for the same three cations. The Na+ current at -100 mV was 0.8-fold larger than the Li+ mediated current, again with little or no measurable K+ current. Thus, the magnitude of the amiloride-sensitive current of alpha gamma channels is Li+ > Na+ >> K+, a profile similar to that for wild-type alpha beta gamma channels (Canessa et al., 1994) and for homomeric alpha  channels (Canessa et al., 1993). In contrast, the alpha beta channel currents were Na+>Li+>>K+.


Fig. 1. Current-voltage relationships of amiloride-sensitive currents of oocytes injected with equal amounts of cRNAs from alpha  and gamma subunits (A), alpha  and beta  subunits (B), and CH3 with alpha  subunit (C) measured in the presence of bathing solutions that contain 150 mM K+, Na+ or Li+ as the gluconate salt. Oocytes were voltage clamped and the membrane potential was changed in 20-mV steps from -180 to 80 mV before and after the addition of 50 µM amiloride to the bath. Curves represent the difference of whole-cell currents before and after the addition of amiloride. Values were normalized to the current measured in the presence of Na+ at -100 mV membrane potential. Each point is the mean of 8 different oocytes, error bars represent SEM.
[View Larger Version of this Image (20K GIF file)]

Characteristics of alpha beta and alpha gamma Unitary Currents

Single channel currents were examined in cell-attached patches from oocytes injected with alpha gamma or alpha beta cRNAs. For patch clamp experiments, we selected oocytes that expressed >1 µA of whole-cell current. Fig. 2, A and B, show unitary currents for alpha beta and alpha gamma channels, respectively, for a range of holding potentials (-Vp). These records with their long openings and closures are similar to those obtained from alpha beta gamma in oocytes (not shown). With 150 mM NaCl in the pipette, the single channel conductance of alpha gamma channels was 6.5 pS (n = 9, Fig. 3 A) and, with 150 mM Li+, was 10.8 pS (n = 5, Fig. 3 A). Thus, the larger unitary conductance for Li+ than for Na+ of alpha gamma channels is similar to alpha beta gamma channels (Canessa et al., 1994). In contrast, the single channel conductances of alpha beta channels were 5.1 pS (n = 5, Fig. 3 B) for Na+ and 4.2 pS (n = 6, Fig. 3 B) for Li+, therefore the Li+/Na+ current ratio of alpha beta is close to 1. The magnitude and Li+/Na+ ratios of unitary currents are in agreement with the data obtained with measurements of whole-cell currents shown in Fig. 1.



Fig. 2. Records of unitary currents from cell-attached patches of oocytes co-injected with alpha  and gamma  (A) or with alpha  and beta  (B) subunits. -Vp refers to the negative value of the pipette holding potential. The short solid line to the right of each trace represents the minimal current level observed (closed level). Downward deflections represent inward currents (channel opening). There are at least four channels present in the patch shown in A and two channels in the patch shown in B.
[View Larger Versions of these Images (21 + 18K GIF file)]


Fig. 3. Current-voltage (I-V) relationships for inward alpha gamma (A) and alpha beta (B) unitary currents recorded from cell attached patches with either 150 mM NaCl in the pipette and the bath or 150 mM LiCl in the pipette and the bath. Data points are from a total of 5-9 separate experiments. The solid line represents the prediction from the constant field equation (Hille, 1992).
[View Larger Version of this Image (16K GIF file)]

To correlate the incidence of channels with macroscopic currents under the different injection conditions, we assessed the number of channels per patch. Oocytes injected with alpha beta gamma had average macroscopic currents of 10 µA (ranged from 3 to 12 µA in 20 oocytes) and the number of channels per patch was at least 5. The average whole-cell current of alpha beta and alpha gamma injected oocytes was 1.9 (ranged from 0.2 to 2.5 µA in 40 oocytes) and 2.7 µA (ranged from 0.15 to 3.5 µA in 30 oocytes), respectively. The alpha beta and alpha gamma patches contained 1-4 channels which is less than the >= 5 per patch observed with alpha beta gamma . These data indicate that the density of active channels in the plasma membrane of alpha gamma and alpha beta injected oocytes is less than that of alpha beta gamma injected oocytes. In summary, these results demonstrate that the lower magnitude of whole-cell currents when alpha  and gamma  or alpha  and beta  are co-expressed, compared with alpha beta gamma , is a result of fewer channels in the plasma membrane and not to marked reduction in single channel conductance or open probability.

Inhibition of alpha gamma and alpha beta Channels by the Blocker Amiloride and Its Analogues

The epithelial sodium channel is reversibly blocked by the potassium sparing diuretic amiloride (3,5-diamino- N -(aminoiminomethyl) - 6 - chloropyrazinecarboxamide) (Garty and Benos, 1988). The amiloride molecule has a guanidinium group that is positively charged at physiological pH and a pyrazine ring. Aromatic substitutions on the guanidinium moiety (e.g., benzamil or phenamil) increase the potency of the block by approximately 10-fold (Kleyman and Cragoe, 1988). The half maximal concentration of amiloride block (Ki) is in the order of 0.1 µM in the cortical collecting tubule, distal colon, and toad bladder. The amiloride and benzamil Kis of the cloned ENaC measured in oocytes injected with alpha beta gamma cRNAs are also 0.1 and 0.01 µM, respectively (Canessa et al., 1994).

We obtained the Ki of amiloride, benzamil, and guanidinium of alpha gamma and alpha beta channels by measuring oocyte whole-cell currents after the addition to the bathing solution of increasing concentrations of these blockers from 0.001 to 100 µM (see Fig. 5). These measurements were performed with 150 mM Na+ in the bath solution and with the membrane potential held at -100 mV. For alpha gamma channels the Ki of amiloride was 0.13 ± 0.05 µM (see Fig. 5 A) and the Ki of benzamil was 0.015 ± 0.004 µM (see Fig. 5 B). For alpha beta channels the Ki of amiloride was 4 ± 0.4 µM (see Fig. 5 A), and the Ki of benzamil was 0.4 ± 0.09 µM (see Fig. 5 B). Thus, alpha beta channels have lower affinity for amiloride and benzamil than alpha gamma channels.


Fig. 5. Dose-response curves of inhibition of Na+ currents by amiloride (A), benzamil (B), and guanidinium (C) of oocytes co-injected with alpha  and gamma  cRNAs (square ), alpha  and beta  cRNAs (bullet ), and CH3 and alpha  cRNAs (black-diamond ). Similar response to CH3 was obtained with chimera CH4. Measurements were obtained with the two-electrode voltage clamp technique in the presence of 150 mM Na+ gluconate in the bath and at -100 mV membrane potential. Data points represent the mean of 10 different oocytes. Vertical bars represent the SEM.
[View Larger Version of this Image (16K GIF file)]

Both amiloride and benzamil contain a guanidinium group, a monovalent positively charged molecule that acts as a pore blocker (Palmer, 1990). We measured the effectiveness of blockade by guanidinium for alpha gamma and alpha beta channels. Fig. 5 C shows that, in contrast to amiloride and benzamil, guanidinium has an equal Ki (10 ± 2.5 mM) for alpha gamma and alpha beta channels.

To localize the structural domains that determine amiloride affinity we constructed several chimeric proteins of gamma  and beta  subunits. Fig. 4 shows linear representations of the gamma -beta chimeric constructs (CH). M1 and M2 represent the first and second transmembrane domains of the subunit proteins. Sequences corresponding to gamma  are shown in white and sequences corresponding to beta  are shown in black. The numbers at the left and right of the arrows indicate the amino acids of gamma  and beta  subunits at the junction between the two subunits, respectively. We also made the reciprocal beta -gamma chimeras that contained the amino terminus of beta  and the carboxy terminus of gamma . All these constructs were not functional when expressed either alone or when they were co-injected with wild-type alpha  subunit (data not shown).


Fig. 4. Linear representation of gamma -beta chimeras and dimer constructs. Numbers in the chimeras indicate the amino acid positions of the corresponding gamma  and beta  polypeptides from rat, and the arrows indicate the junction between gamma  and beta  subunits.
[View Larger Version of this Image (24K GIF file)]

When we examined the gamma -beta chimeric constructs co-injected with alpha  subunit, only channels containing chimeras CH1 and CH2 showed a high affinity for amiloride with Ki of 0.12 µM. For channels containing CH3 and CH4 the Ki of amiloride was 3.7 ± 0.41 µM (Fig. 5 A), similar to the value observed for alpha beta . The transition from high to low amiloride affinity occurred with chimeras CH2 and CH3. CH3 differs from CH2 only by 15 amino acids from the beta  subunit just proximal to the second transmembrane domain. Therefore, the results obtained with the expression of gamma -beta chimeras suggest that a short stretch of the amino acids before the second transmembrane domain of the beta  subunit are important in determining amiloride affinity.

In contrast to amiloride inhibition, measurements of guanidinium Ki gave similar values for alpha gamma , alpha beta , and alpha -chimeric (CH1, CH2, CH3, and CH4) channels indicating that the guanidinium binding site is similar in all these proteins. Since amiloride and benzamil differ from guanidinium in having an attached pyrazine ring, the data indicate the presence of two distinct binding sites in the channel protein; one site for the pyrazine ring and the other site for the guanidinium group.

Since the amiloride block of epithelial sodium channels is known to be voltage dependent (Palmer, 1985; Warncke and Lindemann, 1985), we examined whether the voltage dependence of the block by amiloride was similar in alpha gamma and alpha beta channels. For this purpose, we measured the Ki of amiloride at various holding potentials (Ki(V)) ranging from -180 to 50 mV in the presence of only 30 mM Na+ in the bathing solution to enhance the outward currents at positive membrane potentials. Fig. 6 shows the Ki for alpha gamma and alpha beta channels normalized to the values obtained at -100 mV and plotted against membrane voltage. The amiloride block of alpha gamma and alpha beta channels exhibited virtually identical linear relationships with respect to membrane voltage. We calculated the fraction of the electric field that the blocker traverses to reach the site (delta ) according to the equation:
K<SUB>i</SUB>(V )=K<SUB>i</SUB>(0)exp(ZδFV/RT),


Fig. 6. Effect of membrane potential on amiloride Ki for alpha gamma (square ), and alpha beta (bullet ) channels. Membrane potential was held between -180 and +50 mV. These measurements were obtained with 30 mM Na-gluconate in the bath solution. The Ki were normalized to the values obtained at -100 mV. Data points represent the mean of 8 different oocytes. Vertical bars represent the SEM.
[View Larger Version of this Image (13K GIF file)]

where Ki (0) is the value of Ki at 0 mV, Z is the charge valence of the blocker, which is set to 1, and F, R, and T have their usual meaning. At 22°C, the value of delta  was 0.133 ± 0.012 for alpha gamma and 0.153 ± 0.002 for alpha beta . These values are similar to those reported by Palmer (1985) in toad urinary bladder. From these results, it is reasonable to assume that amiloride senses the same magnitude of the transmembrane electrical field in both types of channels.

It has been shown for wild-type epithelial sodium channels, that external Na+ and amiloride interact competitively, so that the Ki for amiloride increases in the presence of high external sodium concentration. Since alpha gamma and alpha beta channels also differ significantly in their Na+ affinity, it was interesting to examine whether the two types of channels exhibit the same competitive effect with external Na+. We measured whole-cell currents in 15, 30, and 150 mM external Na+ at a membrane potential of -100 mV, the ionic strength was kept constant with NMDG gluconate. As shown in Fig. 7, increasing external Na+ concentration from 15 to 150 mM changed the Ki of alpha gamma channels from 0.045 ± 0.005 to 0.104 ± 0.025 µM and that of alpha beta channels from 2.11 ± 0.33 to 4.43 ± 0.66 µM. Thus, both alpha gamma and alpha beta channels showed a two-fold increase in amiloride Ki for a 10-fold increase in Na+ concentration.


Fig. 7. Effect of Na+ concentration on amiloride Ki for alpha gamma (square ) and alpha beta (bullet ) channels. Measurements of Ki were made at a holding potential of -100 mV in 4 different oocytes.
[View Larger Version of this Image (12K GIF file)]

In summary, alpha gamma and alpha beta channels have a similar Ki for guanidinium, a similar voltage dependence of amiloride inhibition, and a similar attenuation of amiloride block by external Na+. These observations are consistent with the notion that the guanidinium group on amiloride interacts with comparable site(s) in the outer mouth of the channel pore of both alpha beta and alpha gamma channels.

Apparent Na+ and Li+ Affinities of alpha gamma , alpha beta Channels and gamma -beta Chimeras

Macroscopic currents of wild-type channels can be described by Michaelis-Menten curves with half-maximal concentrations (Km) of 10-30 mM for Na+ and 30-50 mM for Li+, depending on the tissue and the method of measurements (Olans et al., 1984; Palmer and Frindt, 1988; Puoti et al., 1995). We investigated whether alpha gamma and alpha beta channels differ in apparent affinities Km for external Na+ and Li+ ions from wild-type channels. We measured the amiloride-sensitive currents induced by increasing the concentrations of Na+ and Li+ gluconate from 0 to 180 mM in the bathing solution while the membrane potential was held at -100 mV. The results are shown in Fig. 8. We found that alpha gamma channels had an apparent Km of 35 ± 6 mM for Na+ and of 60 ± 5 mM for Li+, values similar to those previously reported for alpha beta gamma channels when studied under similar conditions. In contrast, the apparent Km for Na+ and for Li+ of alpha beta channels were much larger, estimated values >180 mM. These values represent only an estimation of the actual Km since the largest cation concentration used in these measurements was 180 mM. Further increase in the bath concentration was not tolerated by the oocytes due to the high osmolality of the solution.


Fig. 8. Amiloride-sensitive current of oocytes injected with equal amounts of cRNAs from alpha  and gamma  subunits (square ), alpha  and beta  subunits (bullet ), and alpha  subunit and CH4 (black-diamond ) in the presence of increasing concentrations of Na+ (A) and Li+ (B) in the bath solution. Values were normalized to the maximal current. Data points were fitted with the Michaelis-Menten equation. Each curve represents the mean of 9 oocytes.
[View Larger Version of this Image (17K GIF file)]

Interestingly, the gamma -beta chimeric constructs (CH1 to CH4) exhibit an apparent Km for Na+ and for Li+ (Fig. 4), and ILi+/INa+ at -100 mV (Fig. 1) similar to alpha gamma channels. Channels formed by alpha  and CH1 or CH2 showed amiloride Ki and apparent Km for Na+ similar to alpha gamma , whereas channels formed by alpha  and CH3 or CH4 showed amiloride Ki similar to alpha beta (Fig. 5) but an apparent Km for Na+ similar to alpha gamma channels. The results indicate that in contrast to amiloride, the low apparent Km for external ions in alpha beta channels is determined by the first two-thirds of the beta  subunit.

Effect of Expression of Varied Ratios of ENaC Subunits

In additional experiments we investigated whether the presence of different ratios of alpha  and beta  subunits would result in the formation of channels with different amiloride and cation affinities. For that purpose we co-injected alpha  and beta  cRNAs into oocytes in the following ratios: 1alpha to 10beta ; 1alpha to 5beta ; 1alpha to 1beta ; 5alpha to 1beta ; and 10alpha to 1beta . We then examined whether the amiloride Ki or the apparent Km for Na+ of alpha beta channels changed in proportion to the ratios of alpha  and beta subunits. Similar experiments were performed with the corresponding ratios of alpha  and gamma  subunit cRNAs.

There was no significant difference in either Na+ or Li+ affinities, or in amiloride Ki for the various subunit ratios. This observation indicates that even with an excess of beta  or gamma  subunits, the properties of the expressed channels do not change, suggesting that the stoichiometry of both alpha beta and alpha gamma channels is fixed.

The magnitude of Na+ and Li+ amiloride-sensitive currents obtained with the various ratios of alpha /gamma and alpha /beta cRNAs are shown in Fig. 9. The largest currents were observed with the 1alpha /1gamma and 1alpha /1beta ratios and the magnitude of the currents decreased progressively when the ratios were made 10alpha /1beta or 1alpha /10beta (Fig. 9 A) or 10alpha /1gamma or 1alpha /10 gamma  (Fig. 9 B).



Fig. 9. Effect of varying the concentration ratio of cRNAs in the magnitude of amiloride-sensitive whole cell Na+ (gray bars) and Li+ (black bars) currents: (A) alpha  and beta ; (B) alpha  and gamma ; (C) beta alpha -dimer and alpha  or beta ; (D) gamma alpha -dimer and alpha  or gamma . Oocytes were injected with equal amount of cRNA that was distributed in concentration ratios as follows (numbers in parentheses indicate the column on the appropriate graph). (A) 10alpha /1beta (1), 5alpha /1beta (2), 1alpha /1beta (3), 1alpha /5beta (4), and 1alpha /10beta (5). (B) 10alpha /1gamma (1), 5alpha /1gamma (2), 1alpha /1gamma (3), 1alpha /5gamma (4), and 1alpha / 10gamma (5). (C) beta alpha -dimer alone (1), 1alpha /1beta (2), 1beta alpha -dimer/1alpha (3), 1beta alpha -dimer/2alpha (4), 1beta alpha -dimer/3alpha (5), 1beta alpha -dimer/1beta (6), 1beta alpha -dimer/2beta (7), beta alpha -dimer/3beta (8), and 1beta alpha -dimer/1gamma (9). (D) 1gamma alpha -dimer alone (1), 1alpha /1gamma (2), 1gamma alpha -dimer/1alpha (3), 1gamma alpha -dimer/2alpha (4), 1gamma alpha -dimer/3alpha (5), 1gamma alpha -dimer/1gamma (6), 1gamma alpha -dimer/2gamma (7), gamma alpha -dimer/3alpha (8), and 1gamma alpha -dimer/1beta (9). Each bar represents the mean of 6-12 oocytes.
[View Larger Versions of these Images (19 + 23 + 19 + 23K GIF file)]

To examine further the ratio of subunits we constructed beta alpha -dimers that contained all the amino acids of the beta  subunit linked to all the amino acids of the alpha  subunit by the addition of a unique restriction site ClaI that introduced a short linker of two new amino acids: isoleucine and aspartic acid between alpha  and beta . We also constructed gamma alpha -dimers that contained all the gamma  subunit linked to all the alpha  subunit by the same two amino acids. The beta alpha and gamma alpha -dimers were functional when injected alone in oocytes in the absence of wild-type monomeric alpha  subunits. The expressed amiloride-sensitive current was indistinguishable in magnitude and properties from the current induced by co-injection of alpha  and beta  or of alpha  and gamma  subunits, respectively. When beta alpha dimers were co-injected with increasing amounts of alpha  or beta  subunits, or when gamma alpha dimers were co-injected with increasing amounts of alpha  or gamma  subunits the magnitude of the amiloride-sensitive current did not increase (Fig. 9, C and D). However, co-injection of alpha beta -dimers with gamma  subunit induced an eight-fold increase in current and changed the Li+/Na+ permeability to >1. Co-injection of alpha gamma -dimers with beta  subunit also induced a large increment of current without changing the functional properties, indicating that the beta alpha - and alpha gamma -dimers appear to be competent for association with gamma  and beta  subunits, respectively to form functional hetero-multimeric channels.

These results suggest that alpha beta and alpha gamma channels are formed by a 1:1 ratio of alpha  and beta  and of alpha  and gamma  subunits, respectively. However, the number of each subunit contributing to functional channels cannot be determined from our data.


DISCUSSION

Physiological Relevance for Diversity of Epithelial Sodium Channels

Hetero-multimeric channels such as ligand-gated receptors (Nakanishi et al., 1990), cyclic nucleotide-gated channels (Bradley et al., 1991; Chen et al., 1993), and certain voltage-gated potassium channels (Isacoff et al., 1990; Krapivinsky et al., 1995) associate their subunits in various combinations to generate different channels, each with unique functional properties. In the present study, we have examined whether the three subunits of ENaC, alpha , beta , and gamma , can also associate in various combinations to form channels with distinct functional characteristics. The existence of a diversity of sodium channels is suggested by reports describing amiloride-sensitive sodium channels with properties that do not correspond to those of ENaC (Cantiello et al., 1989; MacGregor et al., 1994; Yue et al., 1994). For instance, it has been shown that in fetal lung epithelial cells there are two populations of amiloride-sensitive sodium channels, one with high affinity (Ki = 0.019 µM) and the other with low affinity (Ki = 1.5 µM) for benzamil (Matalon et al., 1993). Sodium-selective channels with ILi+/INa+ current ratio <1 and relative low amiloride affinity (Ki = 0.87 mM) have been described in membranes of rat macrophages (Negulyaev and Vedernikova, 1994). In the apical membrane of rabbit proximal tubules, amiloride-sensitive highly sodium-selective channels have been observed that have a larger single channel conductance than those present in the distal tubule (Gögelein and Greger, 1986).

These sodium-selective channels may be formed by new subunit proteins from the ENaC family or by combinations of the already known ENaC subunits. Waldmann et al. (1995a) have cloned a delta  subunit that can associate with beta  and gamma  but not with alpha  to form functional channels. The ILi+/INa+ ratio of delta  is <1, and the Ki for amiloride is 2.6 µM. These properties are similar to those of alpha beta channels. The expression of the delta  subunit overlaps with the expression of alpha , beta , and gamma  in several tissues including the kidney, although it is not yet known which segments of the nephron express the delta  subunit or whether there is colocalization with the other ENaC subunits to form functional channels in vivo.

Recently, Farman and colleagues (1997) have reported heterogeneity at the level of expression of the subunits of ENaC in respiratory epithelia. A large prevalence of alpha  and gamma  expression was found in a subpopulation of alveolar cells, in tracheal epithelium as well as in nasal and tracheal gland acini, with little or no beta subunit expression. In other tissues, such as the epithelium of the distal colon, the level of expression of individual subunits is highly regulated by aldosterone. Under normal conditions these cells only express the alpha  subunit; following stimulation by aldosterone, however, large amounts of beta  and gamma  cRNAs are expressed (Asher et al., 1997). Differential expression of ENaC subunits could represent a mechanism of regulating Na+ reabsorption in tissues. For instance, cells that express only alpha  and gamma  or alpha , beta , and gamma  subunits will form channels with high sodium affinity and high amiloride sensitivity, however the maximal capacity for Na+ absorption in alpha  and gamma  cells will be much smaller than in cells that express simultaneously the three subunits (Canessa et al., 1994). The high affinity for external Na+ of alpha gamma and alpha beta gamma channels is important for efficient Na+ absorption in tissues such as the cortical-collecting tubule of the kidney where the luminal Na+ concentration reaches very low levels in states of Na+ depletion. On the other hand, cells that only express alpha  and beta subunits will form channels with low affinity for Na+, which will limit Na+ absorption unless the concentration of external Na+ is large. Therefore, alpha beta channels will only be active when exposed to high Na+ concentrations such as in the lumen of proximal tubules, in the pulmonary airways, or in surrounding macrophages (although the functional significance of ENaC in blood cells is still unknown).

In summary, our results indicate that the ENaC subunits can indeed generate a diversity of channels with different functional and pharmacological characteristics. Epithelial Na+ channels like other multimeric channel proteins have the potential for complex regulation by differential expression of their subunits during development and under the influence of various hormones and stimuli.

Ki of Amiloride

The most specific inhibitor of Na+ channels in high- resistance epithelia is the potassium-sparing diuretic drug amiloride. Several observations indicate that this drug acts by obstructing the conducting pore: (a) it has been demonstrated that the positive charge on the guanidinium moiety is essential for blocking; (b) the Ki of amiloride is sensitive to the luminal Na+ activity indicating an amiloride-ion competition effect; and (c) the channel-amiloride association/dissociation rate constants are voltage dependent. These findings are consistent with the notion that amiloride blocks the channel from the outer part of the conducting pore. However, the molecular site(s) on the channel protein to which the blocker binds has not yet been defined.

We have shown that the amiloride affinity of alpha beta channels is significantly lower than that exhibited by alpha beta gamma and alpha gamma channels and have presented evidence that a short stretch of 15 amino acids before the second transmembrane domain of the beta  subunit determines the amiloride Ki of alpha beta channels. In spite of a 25-fold difference in amiloride and benzamil Ki of alpha gamma and alpha beta , both types of channels exhibited the same affinity for guanidinium with a Ki of 15 mM. The results indicate that the amiloride molecule interacts with the channel protein in at least two distinct sites. At one site, guanidinium binds loosely to the outer pore of the channel. At another distinct site, the pyrazine group binds, increasing the affinity of the blocker by several hundred-fold. Three key observations support the notion that guanidinium binds to a similar site in alpha beta and alpha gamma channels: (a) similar guanidinium Ki; (b) a similar electrical distance (delta ) sensed by the charged moiety of amiloride; and (c) similar competitive effe