|
||
From the Department of Cellular and Molecular Physiology, Yale University School of Medicine, New Haven, Connecticut 06520-8026
The epithelial sodium channel is a multimeric protein formed by three homologous subunits:
,
,
and
; each subunit contains only two transmembrane domains. The level of expression of each of the subunits is
markedly different in various Na+ absorbing epithelia raising the possibility that channels with different subunit
composition can function in vivo. We have examined the functional properties of channels formed by the association of
with
and of
with
in the Xenopus oocyte expression system using two-microelectrode voltage clamp
and patch-clamp techniques. We found that 
channels differ from 
channels in the following functional
properties: (a) 
channels expressed larger Na+ than Li+ currents (INa+/ILi+ 1.2) whereas 
channels expressed smaller Na+ than Li+ currents (INa+/ILi+ 0.55); (b) the Michaelis Menten constants (Km) of activation of current by
increasing concentrations of external Na+ and Li+ of 
channels were larger (Km > 180 mM) than those of 
channels (Km of 35 and 50 mM, respectively); (c) single channel conductances of 
channels (5.1 pS for Na+ and
4.2 pS for Li+) were smaller than those of 
channels (6.5 pS for Na+ and 10.8 pS for Li+); (d) the half-inhibition
constant (Ki) of amiloride was 20-fold larger for 
channels than for 
channels whereas the Ki of guanidinium
was equal for both 
and 
. To identify the domains in the channel subunits involved in amiloride binding, we
constructed several chimeras that contained the amino terminus of the
subunit and the carboxy terminus of the
subunit. A stretch of 15 amino acids, immediately before the second transmembrane domain of the
subunit,
was identified as the domain conferring lower amiloride affinity to the 
channels. We provide evidence for the
existence of two distinct binding sites for the amiloride molecule: one for the guanidium moiety and another for
the pyrazine ring. At least two subunits
with
or
contribute to these binding sites. Finally, we show that the
most likely stoichiometry of 
and 
channels is 1
:1
and 1
:1
, respectively.
Epithelial sodium channels (ENaC)1 mediate sodium
reabsorption in a variety of tissues (for review, see Garty
and Benos, 1988
; Rossier et al., 1994
). Na+ channels
are located in the apical membranes of epithelia such as the distal nephron and colon, the ducts of salivary
and sweat glands, and the respiratory tract. Molecular
cloning of ENaC has revealed that the channel is
formed by three homologous subunits,
,
, and
(Canessa et al., 1994
), that share 34-37% identity at the
amino acid level. Expression of the three subunits in a heterologous system such as Xenopus oocytes reconstitutes channels with properties similar to those present
in native tissues: high selectivity of sodium over potassium (PNa+/PK+ > 20), half-inhibition constant (Ki) of
amiloride of 0.10 µM, and only a slight voltage dependence of the open probability (Hamilton and Eaton,
1985
; Palmer and Frindt, 1986
; Canessa et al., 1994
). Canessa et al. (1994)
have previously shown that co-
expression of
,
, and
subunits is necessary to induce maximal levels of channel activity. Single subunits
produce amiloride-sensitive currents of small magnitude (
subunit expressed alone induces only 1% of
the maximal whole-cell current) or no current at all (
or
expressed alone or co-expression of the two subunits do not induce any current). However, co-expression of
and
subunits or of
and
subunits results
in about 15-20% of the maximal magnitude of amiloride-sensitive whole cell current.
The total number of subunits and the stoichiometry
of the subunits in ENaC have not yet been determined.
Additionally, it is not known whether the subunit composition can be varied to give channels with different
functional properties. The physiological relevance of
channels of different subunit composition is supported by the observation that not all Na+ absorbing epithelia
express the three subunits of ENaC. In the lung there is
a heterogeneity of expression with some cells having only
and
subunits (Farman et al., 1997
); in colonic
epithelia, in the absence of stimulation by aldosterone,
only the
subunit is expressed (Lingueglia et al., 1994
;
Asher et al., 1997
). These findings raise the possibility
that, at least in certain tissues, only one or two ENaC
subunits may be sufficient to form functional sodium
channels in vivo.
Because little is known about the properties of channels that consist of only two of the ENaC subunits, we
describe the expression and functional properties of
channels formed by the combination of
and
and of
and
subunits. We found that 
and 
channels differ in sensitivity to the blocker amiloride, Km values
for activation by external Na+ and Li+, and single channel conductances. Maximal currents were observed when the cRNAs injected of
and
, and
and
were
of 1:1 ratio; large variations from this ratio decreased
the magnitude of the amiloride-sensitive currents, but
the distinct functional properties of the 
and 
channels were maintained suggesting that the most
likely stoichiometry of 
and 
channels is 1
:1
and
1
:1
, respectively. In addition, we identified a short
stretch of amino acids before the second transmembrane domain that determines amiloride affinity. We
discuss a model that describes the presence of at least
two distinct binding sites for the amiloride molecule,
one site for the guanidinium moiety and another for
the pyrazine ring.
Expression of Sodium Channels in Oocytes
cDNAs were propagated in the transcription-competent vector
pSD-5 in Escherichia coli DH5
. Capped cRNAs were transcribed in vitro from linearized cDNAs using SP6 RNA polymerase. Stage V-VI Xenopus oocytes were isolated by partial ovariectomy under tricaine anesthesia and then defolliculated by treatment with 1 mg/ml collagenase (Type 1A; Sigma Chemical Co., St. Louis,
MO) in zero Ca2+ modified Barth's solution (MBS), containing
in mmol/liter: 85 NaCl, 2.4 NaHCO3, 1 KCl, 0.8 MgSO4, 0.3 Ca(NO3), 0.4 CaCl2, and 5 HEPES (buffered to pH 7.2) for 1 h at
room temperature. 2-24 h after defolliculation, oocytes were injected with 1-3 ng of each cRNA in a final volume of 50 nl. The
amount of injected cRNA was changed to obtain five conditions
with different ratios of
and
, or of
and
cRNAs. Condition
10
:1
received 3 ng of
and 0.3 ng of
; condition 5
:1
received 3 ng of
and 0.6 ng of
; condition 1
:1
received 3 ng
each of
and
; condition 1
:5
received 0.6 ng of
and 3 ng of
, and condition 1
:10
received 0.3 ng of
and 3 ng of
. Similar experimental protocols were used for the five corresponding

conditions. In experiments where the 
-dimer was injected,
oocytes received 1 ng of 
-dimer cRNA alone or in addition to
1, 2, or 3 ng of
cRNA or 1, 2, or 3 ng of
cRNA. In experiments
where the 
-dimer was injected, oocytes received 1 ng of 
-dimer cRNA alone or in addition to 1, 2, or 3 ng of
cRNA or 1, 2, or 3 ng of
cRNA. Oocytes were kept in MBS with 1.8 mM
Ca2+, supplemented with penicillin (100 U/ml) and streptomycin (100 µg/ml) for 3-5 d at 19°C before experiments.
Electrophysiology
Oocyte whole-cell currents were measured using the two-microelectrode voltage clamp technique (Oocyte Clamp C-725B;
Warner Instrument Corp., Hamden, CT). Epithelial sodium
channel currents were calculated as the difference in whole-cell
current before and after the addition of 100 µM amiloride to the
bathing solution. The bath solution contained in mmol/liter: 1.8 CaCl2; 2 MgCl2; 4 KCl; 5 BaCl2; 5 HEPES, buffered to pH 7.2, and
0-150 mM Na+, Li+, or K+ gluconate. NMDG-gluconate (N -methyl-
D-glucamine) was used to make the total concentration of cation-gluconate 150 mM. Pulse software (HEKA Elektronik, Lambrecht,
Germany) was used to generate voltage pulses. To obtain I-V curves,
the membrane potential was changed from
180 to 80 mV by
20-mV incremental steps of 200-ms duration. Data were collected
and analyzed with a Power Macintosh computer.
The Kms for external Na+ and Li+ were calculated from the amiloride-sensitive component of whole-cell currents (I) induced by varying the concentration (C) of Na+ or Li+ in the bath solution from 0 to 150 mM. The data were fitted to the Michaelis-Menten equation:
|
(1) |
where Imax is the maximal current and Km is the half-activation constant using a nonlinear fit program based on the simplex method.
Dose-response curves for the blockers amiloride, benzamil, and guanidinium were obtained by measuring the change in current induced by adding increasing concentrations of blocker into the bath solution. The data were fitted to the equation:
|
(2) |
where A is the concentration of the blocker and Ki is the inhibition constant. To assess the voltage dependence of amiloride block, the Ki was measured at various membrane holding potentials ranging from
180 to 50 mV. As indicated, in certain experiments the Ki of amiloride was measured in the presence of 150 or 30 mM Na+ in the bathing solution. Results are expressed as
mean ± standard error (SEM), n = number of observations.
Patch Clamp Technique
Single channel recordings were obtained from membrane patches
from Xenopus oocytes (Methfessel et al., 1986
) injected with either (
,
, and
), (
and
), or (
and
) rat ENaC cRNAs. Recording pipettes were constructed from borosilicate glass capillaries (Dagan Corp., Minneapolis, MN) using a Narishige PP83
microelectrode puller (Narishige Scientific Instrument Laboratory, Tokyo, Japan) and were not fire polished. The pipettes had
tip resistances of 2-5 M
and were partially filled with solutions
containing, in mmol/liter: 150 NaCl or LiCl; 1 CaCl2; 1 MgCl2; 5 HEPES, buffered to a final pH of 7.4. Bath solutions contained,
in mmol/liter: 150 NaCl or LiCl; 5 EDTA; 5 HEPES, buffered to a
final pH of 7.4. Experiments were performed at room temperature (~20-22°C).
Single channel currents were recorded from cell-attached
patches with a patch clamp amplifier (Model EPC-7; List Electronics, Darmstadt, Germany, or Model PC-505; Warner Instrument Corp.). The signal was low pass filtered at 500 Hz with an
8-pole bessel filter and stored on video tape after pulse code
modulation (Model PCM-501ES; Sony, Tokyo, Japan). For analysis, data were re-digitized (2 kHz), transferred to a PC, and analyzed using the pCLAMP6 (Axon Instruments Inc., Burlingame,
CA) software system. Data were then filtered at 30-100 Hz for
analysis and display. Single channel conductance was estimated
with linear regression analysis from currents measured from
100 and
40 mV.
Construction of cDNAs
Chimeras of
and
rat ENaC cDNAs were generated by a two-step PCR protocol. CH1 was constructed by amplification of wild-type
template using a complementary sense primer 5
CATCTACAACGCTGCC3
and an antisense
-
hybrid primer
5
CCGCCTCCTGCGGGCGATGATAGAGAAG3
. The
-
hybrid
antisense primer has the 3
half of the sequence complementary
to
and the 5
half complementary to
sequences. The amplification protocol consisted of 20 cycles of 94°C for 45 s, 60°C for 45 s,
and 72°C for 45 s. 1 µl of the first PCR product was mixed with
wild-type
template for the second PCR amplification, the sense
primer of the first PCR reaction, and an antisense primer complementary to
5
AATATTCTGGTACCAGC3
. The amplification protocol consisted of 25 cycles of 94°C for 45 s, 55°C for 50 s,
and 72°C for 50 s. CH2 was constructed by amplification of
template with a complementary sense primer 5
CATCTACAACGCTGCC3
and an antisense
-
hybrid 5
GATCTCCCCAAACTCAATGACACAGACGAC3
. 1 µl of the first PCR reaction
was mixed with
template in a second amplification that contained the sense primer of the first reaction and a specific antisense
primer 5
AATATTCTGGTACCAGC3
. CH3 was constructed by amplification of
template using a complementary sense primer 5
CATCTACAACGCTGCC3
and an antisense
-
hybrid primer 5
GGCCACCCAGGTTGGACAGGAGCATCTC3
.
The second PCR amplification used the first PCR sense primer
and an antisense primer complementary to
5
AATATTCTGGTACCAGC3
. For the first PCR of CH4 a sense
primer
5
CATCTACAACGCTGCC3
with an antisense
-
hybrid primer 5
GATATTTGAGCTCTGGTCCCAGGTGAGAACATT3
were used
to amplify
template. The second amplification used
template,
the same sense primer and an antisense
primer 5
CATCTACAACGCTGCC3
. The products of all the second PCR reactions
were digested with two unique restriction enzymes BglII and
KpnI, and subcloned into the vector pSD5.
Construction of
and
dimers was performed in the following way: The coding regions of the cDNAs of
and
subunits
were linked to form a single polypeptide by the addition of a
unique ClaI site after the last amino acid of the
subunit and before the first methionine of the
subunit using PCR. The
and
cDNAs were digested with ClaI and ligated into a single cDNA
that encodes for the 
polypeptide. Construction of
and
dimer was performed by the addition of a ClaI site at the end of
the coding region of the
cDNA and immediately before the
first methionine of the
subunit using PCR. The
and
cDNAs
were digested with ClaI and ligated into a single cDNA that encodes for one 
polypeptide. The presence of the ClaI site introduced two amino acids (isoleucine and aspartic acid) between
and
subunits and between
and
subunits.
All constructs were sequenced at the Yale facility using an ABI 373 automated DNA sequencer employing dye terminators following a standard protocol supplied by the manufacturer (Applied Biosystems, Inc., Foster City, CA).
Na+ and Li+ Selectivity of Channels with Different Subunit Composition
The native epithelial sodium channel has high selectivity for Na+ over other cations. The only other permeant
ions are Li+ (with a PLi+/PNa+ 1.5) and H+ ions
(Palmer, 1984
). We examined the relative permeabilities for Na+ and Li+ of the amiloride-sensitive current
in oocytes co-injected with equal amounts of
and
or
of
and
cRNAs. The magnitude of the observed
amiloride-sensitive sodium current varied from 0.2 to 3 µA, a level of expression adequate for our whole-cell
studies. The mean currents were 1.9 ± 0.7 µA for 
and 2.7 ± 0.9 µA for 
. Current-voltage relations were
generated in the presence of 150 mM K+, Na+ or Li+ as
the gluconate salt in the bathing solution. Membrane
potentials were changed in 20 mV incremental steps
from
180 to 80 mV. Fig. 1 A shows the relative currents of Na+, Li+, and K+ for 
channels. Current
measurements have been normalized to the amiloride-sensitive Na+ current obtained at
100 mV. At this potential and with this combination of subunits the inward Li+ current was 1.5-fold greater than the Na+ current. There was no significant inward current when the
bath contained 150 mM K+. The small outward current
at depolarizing membrane potentials is probably carried by Na+ because it is substantially reduced by exposing the cells to Na+ free solutions for 24 h (not shown).
Fig. 1 B shows the results of the relative currents
through 
channels for the same three cations. The
Na+ current at
100 mV was 0.8-fold larger than the
Li+ mediated current, again with little or no measurable K+ current. Thus, the magnitude of the amiloride-sensitive current of 
channels is Li+ > Na+ >> K+, a
profile similar to that for wild-type 

channels (Canessa et al., 1994
) and for homomeric
channels (Canessa et al., 1993
). In contrast, the 
channel currents
were Na+>Li+>>K+.
and
subunits (A),
and
subunits (B), and CH3 with
subunit
(C) measured in the presence of bathing solutions that contain
150 mM K+, Na+ or Li+ as the gluconate salt. Oocytes were voltage
clamped and the membrane potential was changed in 20-mV steps
from
180 to 80 mV before and after the addition of 50 µM
amiloride to the bath. Curves represent the difference of whole-cell currents before and after the addition of amiloride. Values
were normalized to the current measured in the presence of Na+
at
100 mV membrane potential. Each point is the mean of 8 different oocytes, error bars represent SEM.
Characteristics of 
and 
Unitary Currents
Single channel currents were examined in cell-attached
patches from oocytes injected with 
or 
cRNAs.
For patch clamp experiments, we selected oocytes that
expressed >1 µA of whole-cell current. Fig. 2, A and B,
show unitary currents for 
and 
channels, respectively, for a range of holding potentials (
Vp). These
records with their long openings and closures are similar to those obtained from 

in oocytes (not shown).
With 150 mM NaCl in the pipette, the single channel
conductance of 
channels was 6.5 pS (n = 9, Fig. 3
A) and, with 150 mM Li+, was 10.8 pS (n = 5, Fig. 3 A).
Thus, the larger unitary conductance for Li+ than for
Na+ of 
channels is similar to 

channels (Canessa
et al., 1994
). In contrast, the single channel conductances of 
channels were 5.1 pS (n = 5, Fig. 3 B) for
Na+ and 4.2 pS (n = 6, Fig. 3 B) for Li+, therefore the
Li+/Na+ current ratio of 
is close to 1. The magnitude and Li+/Na+ ratios of unitary currents are in
agreement with the data obtained with measurements
of whole-cell currents shown in Fig. 1.
and
(A) or with
and
(B) subunits.
Vp refers to the negative
value of the pipette holding potential. The short solid line to the right of each
trace represents the minimal current level
observed (closed level). Downward deflections represent inward currents (channel
opening). There are at least four channels present in the patch shown in A and
two channels in the patch shown in B.

(A)
and 
(B) unitary currents recorded from cell attached patches
with either 150 mM NaCl in the pipette and the bath or 150 mM
LiCl in the pipette and the bath. Data points are from a total of
5-9 separate experiments. The solid line represents the prediction from the constant field equation (Hille, 1992
To correlate the incidence of channels with macroscopic currents under the different injection conditions, we assessed the number of channels per patch.
Oocytes injected with 

had average macroscopic
currents of 10 µA (ranged from 3 to 12 µA in 20 oocytes) and the number of channels per patch was at
least 5. The average whole-cell current of 
and 
injected oocytes was 1.9 (ranged from 0.2 to 2.5 µA in 40 oocytes) and 2.7 µA (ranged from 0.15 to 3.5 µA in 30 oocytes), respectively. The 
and 
patches contained 1-4 channels which is less than the
5 per patch
observed with 

. These data indicate that the density
of active channels in the plasma membrane of 
and

injected oocytes is less than that of 

injected oocytes. In summary, these results demonstrate that the
lower magnitude of whole-cell currents when
and
or
and
are co-expressed, compared with 

, is a
result of fewer channels in the plasma membrane and
not to marked reduction in single channel conductance or open probability.
Inhibition of 
and 
Channels by the Blocker Amiloride
and Its Analogues
The epithelial sodium channel is reversibly blocked by
the potassium sparing diuretic amiloride (3,5-diamino-
N -(aminoiminomethyl) - 6 - chloropyrazinecarboxamide)
(Garty and Benos, 1988
). The amiloride molecule has a
guanidinium group that is positively charged at physiological pH and a pyrazine ring. Aromatic substitutions on the guanidinium moiety (e.g., benzamil or phenamil) increase the potency of the block by approximately 10-fold (Kleyman and Cragoe, 1988
). The half
maximal concentration of amiloride block (Ki) is in the
order of 0.1 µM in the cortical collecting tubule, distal
colon, and toad bladder. The amiloride and benzamil
Kis of the cloned ENaC measured in oocytes injected
with 

cRNAs are also 0.1 and 0.01 µM, respectively
(Canessa et al., 1994
).
We obtained the Ki of amiloride, benzamil, and guanidinium of 
and 
channels by measuring oocyte
whole-cell currents after the addition to the bathing solution of increasing concentrations of these blockers
from 0.001 to 100 µM (see Fig. 5). These measurements were performed with 150 mM Na+ in the bath solution
and with the membrane potential held at
100 mV. For

channels the Ki of amiloride was 0.13 ± 0.05 µM (see
Fig. 5 A) and the Ki of benzamil was 0.015 ± 0.004 µM
(see Fig. 5 B). For 
channels the Ki of amiloride was 4 ±
0.4 µM (see Fig. 5 A), and the Ki of benzamil was 0.4 ± 0.09 µM (see Fig. 5 B). Thus, 
channels have lower
affinity for amiloride and benzamil than 
channels.
and
cRNAs (
),
and
cRNAs (
), and CH3
and
cRNAs (
). Similar response to CH3 was obtained with chimera CH4. Measurements were obtained with the two-electrode
voltage clamp technique in the presence of 150 mM Na+ gluconate in the bath and at
100 mV membrane potential. Data points
represent the mean of 10 different oocytes. Vertical bars represent
the SEM.
Both amiloride and benzamil contain a guanidinium
group, a monovalent positively charged molecule that
acts as a pore blocker (Palmer, 1990
). We measured
the effectiveness of blockade by guanidinium for 
and 
channels. Fig. 5 C shows that, in contrast to
amiloride and benzamil, guanidinium has an equal Ki
(10 ± 2.5 mM) for 
and 
channels.
To localize the structural domains that determine
amiloride affinity we constructed several chimeric proteins of
and
subunits. Fig. 4 shows linear representations of the
-
chimeric constructs (CH). M1 and
M2 represent the first and second transmembrane domains of the subunit proteins. Sequences corresponding to
are shown in white and sequences corresponding to
are shown in black. The numbers at the left
and right of the arrows indicate the amino acids of
and
subunits at the junction between the two subunits, respectively. We also made the reciprocal
-
chimeras that contained the amino terminus of
and the
carboxy terminus of
. All these constructs were not
functional when expressed either alone or when they
were co-injected with wild-type
subunit (data not shown).
-
chimeras and dimer constructs. Numbers in the chimeras indicate the amino acid positions
of the corresponding
and
polypeptides from rat, and the arrows indicate the junction between
and
subunits.
When we examined the
-
chimeric constructs co-injected with
subunit, only channels containing chimeras CH1 and CH2 showed a high affinity for amiloride with Ki of 0.12 µM. For channels containing CH3
and CH4 the Ki of amiloride was 3.7 ± 0.41 µM (Fig. 5 A), similar to the value observed for 
. The transition from high to low amiloride affinity occurred with
chimeras CH2 and CH3. CH3 differs from CH2 only by
15 amino acids from the
subunit just proximal to the
second transmembrane domain. Therefore, the results
obtained with the expression of
-
chimeras suggest
that a short stretch of the amino acids before the second transmembrane domain of the
subunit are important in determining amiloride affinity.
In contrast to amiloride inhibition, measurements of
guanidinium Ki gave similar values for 
, 
, and
-chimeric (CH1, CH2, CH3, and CH4) channels indicating
that the guanidinium binding site is similar in all these
proteins. Since amiloride and benzamil differ from guanidinium in having an attached pyrazine ring, the data indicate the presence of two distinct binding sites in the channel protein; one site for the pyrazine ring and the
other site for the guanidinium group.
Since the amiloride block of epithelial sodium channels is known to be voltage dependent (Palmer, 1985
;
Warncke and Lindemann, 1985
), we examined whether
the voltage dependence of the block by amiloride was
similar in 
and 
channels. For this purpose, we
measured the Ki of amiloride at various holding potentials (Ki(V)) ranging from
180 to 50 mV in the presence of only 30 mM Na+ in the bathing solution to enhance the outward currents at positive membrane potentials. Fig. 6 shows the Ki for 
and 
channels normalized to the values obtained at
100 mV and plotted against membrane voltage. The amiloride block of

and 
channels exhibited virtually identical linear
relationships with respect to membrane voltage. We calculated the fraction of the electric field that the blocker
traverses to reach the site (
) according to the equation:
|

(
), and 
(
) channels. Membrane potential was held between
180 and +50 mV. These measurements were obtained with 30 mM Na-gluconate in the bath solution. The Ki were normalized to
the values obtained at
100 mV. Data points represent the mean
of 8 different oocytes. Vertical bars represent the SEM.
where Ki (0) is the value of Ki at 0 mV, Z is the charge
valence of the blocker, which is set to 1, and F, R, and T
have their usual meaning. At 22°C, the value of
was
0.133 ± 0.012 for 
and 0.153 ± 0.002 for 
. These
values are similar to those reported by Palmer (1985)
in toad urinary bladder. From these results, it is reasonable to assume that amiloride senses the same magnitude of the transmembrane electrical field in both
types of channels.
It has been shown for wild-type epithelial sodium
channels, that external Na+ and amiloride interact
competitively, so that the Ki for amiloride increases in
the presence of high external sodium concentration. Since 
and 
channels also differ significantly in
their Na+ affinity, it was interesting to examine whether
the two types of channels exhibit the same competitive
effect with external Na+. We measured whole-cell currents in 15, 30, and 150 mM external Na+ at a membrane potential of
100 mV, the ionic strength was
kept constant with NMDG gluconate. As shown in Fig.
7, increasing external Na+ concentration from 15 to
150 mM changed the Ki of 
channels from 0.045 ± 0.005 to 0.104 ± 0.025 µM and that of 
channels from 2.11 ± 0.33 to 4.43 ± 0.66 µM. Thus, both 
and

channels showed a two-fold increase in amiloride Ki
for a 10-fold increase in Na+ concentration.

(
) and 
(
) channels. Measurements of Ki were made at a
holding potential of
100 mV in 4 different oocytes.
In summary, 
and 
channels have a similar Ki
for guanidinium, a similar voltage dependence of amiloride inhibition, and a similar attenuation of amiloride
block by external Na+. These observations are consistent
with the notion that the guanidinium group on amiloride
interacts with comparable site(s) in the outer mouth of
the channel pore of both 
and 
channels.
Apparent Na+ and Li+ Affinities of 
, 
Channels and
-
Chimeras
Macroscopic currents of wild-type channels can be described by Michaelis-Menten curves with half-maximal
concentrations (Km) of 10-30 mM for Na+ and 30-50
mM for Li+, depending on the tissue and the method
of measurements (Olans et al., 1984
; Palmer and
Frindt, 1988
; Puoti et al., 1995
). We investigated whether

and 
channels differ in apparent affinities Km for
external Na+ and Li+ ions from wild-type channels. We
measured the amiloride-sensitive currents induced by
increasing the concentrations of Na+ and Li+ gluconate from 0 to 180 mM in the bathing solution while
the membrane potential was held at
100 mV. The results are shown in Fig. 8. We found that 
channels
had an apparent Km of 35 ± 6 mM for Na+ and of 60 ± 5 mM for Li+, values similar to those previously reported for 

channels when studied under similar
conditions. In contrast, the apparent Km for Na+ and
for Li+ of 
channels were much larger, estimated values >180 mM. These values represent only an estimation of the actual Km since the largest cation concentration used in these measurements was 180 mM. Further
increase in the bath concentration was not tolerated by
the oocytes due to the high osmolality of the solution.
and
subunits (
),
and
subunits (
), and
subunit and CH4 (
) in the presence of increasing concentrations of Na+ (A) and Li+ (B) in the bath solution.
Values were normalized to the maximal current. Data points were
fitted with the Michaelis-Menten equation. Each curve represents
the mean of 9 oocytes.
Interestingly, the
-
chimeric constructs (CH1 to
CH4) exhibit an apparent Km for Na+ and for Li+ (Fig.
4), and ILi+/INa+ at
100 mV (Fig. 1) similar to 
channels. Channels formed by
and CH1 or CH2
showed amiloride Ki and apparent Km for Na+ similar
to 
, whereas channels formed by
and CH3 or CH4
showed amiloride Ki similar to 
(Fig. 5) but an apparent Km for Na+ similar to 
channels. The results indicate that in contrast to amiloride, the low apparent Km
for external ions in 
channels is determined by the
first two-thirds of the
subunit.
Effect of Expression of Varied Ratios of ENaC Subunits
In additional experiments we investigated whether the
presence of different ratios of
and
subunits would
result in the formation of channels with different
amiloride and cation affinities. For that purpose we co-injected
and
cRNAs into oocytes in the following
ratios: 1
to 10
; 1
to 5
; 1
to 1
; 5
to 1
; and 10
to 1
. We then examined whether the amiloride Ki or
the apparent Km for Na+ of 
channels changed in
proportion to the ratios of
and
subunits. Similar experiments were performed with the corresponding ratios of
and
subunit cRNAs.
There was no significant difference in either Na+ or
Li+ affinities, or in amiloride Ki for the various subunit
ratios. This observation indicates that even with an excess of
or
subunits, the properties of the expressed
channels do not change, suggesting that the stoichiometry of both 
and 
channels is fixed.
The magnitude of Na+ and Li+ amiloride-sensitive
currents obtained with the various ratios of
/
and
/
cRNAs are shown in Fig. 9. The largest currents were
observed with the 1
/1
and 1
/1
ratios and the
magnitude of the currents decreased progressively when
the ratios were made 10
/1
or 1
/10
(Fig. 9 A) or
10
/1
or 1
/10
(Fig. 9 B).
and
; (B)
and
; (C) 
-dimer and
or
; (D) 
-dimer and
or
. Oocytes were injected with equal
amount of cRNA that was distributed in concentration ratios as follows (numbers in parentheses indicate the column on the appropriate
graph). (A) 10
/1
(1), 5
/1
(2), 1
/1
(3), 1
/5
(4), and 1
/10
(5). (B) 10
/1
(1), 5
/1
(2), 1
/1
(3), 1
/5
(4), and 1
/
10
(5). (C) 
-dimer alone (1), 1
/1
(2), 1
-dimer/1
(3), 1
-dimer/2
(4), 1
-dimer/3
(5), 1
-dimer/1
(6), 1
-dimer/2
(7), 
-dimer/3
(8), and 1
-dimer/1
(9). (D) 1
-dimer alone (1), 1
/1
(2), 1
-dimer/1
(3), 1
-dimer/2
(4), 1
-dimer/3
(5), 1
-dimer/1
(6), 1
-dimer/2
(7), 
-dimer/3
(8), and 1
-dimer/1
(9). Each bar represents the mean of 6-12 oocytes.
To examine further the ratio of subunits we constructed 
-dimers that contained all the amino acids
of the
subunit linked to all the amino acids of the
subunit by the addition of a unique restriction site ClaI
that introduced a short linker of two new amino acids:
isoleucine and aspartic acid between
and
. We also
constructed 
-dimers that contained all the
subunit
linked to all the
subunit by the same two amino acids.
The 
and 
-dimers were functional when injected
alone in oocytes in the absence of wild-type monomeric
subunits. The expressed amiloride-sensitive current was
indistinguishable in magnitude and properties from the current induced by co-injection of
and
or of
and
subunits, respectively. When 
dimers were co-injected with increasing amounts of
or
subunits, or
when 
dimers were co-injected with increasing
amounts of
or
subunits the magnitude of the amiloride-sensitive current did not increase (Fig. 9, C and D). However, co-injection of 
-dimers with
subunit induced an eight-fold increase in current and changed
the Li+/Na+ permeability to >1. Co-injection of 
-dimers with
subunit also induced a large increment
of current without changing the functional properties,
indicating that the 
- and 
-dimers appear to be competent for association with
and
subunits, respectively to form functional hetero-multimeric channels.
These results suggest that 
and 
channels are
formed by a 1:1 ratio of
and
and of
and
subunits, respectively. However, the number of each subunit contributing to functional channels cannot be determined from our data.
Physiological Relevance for Diversity of Epithelial Sodium Channels
Hetero-multimeric channels such as ligand-gated receptors (Nakanishi et al., 1990
), cyclic nucleotide-gated
channels (Bradley et al., 1991
; Chen et al., 1993
), and
certain voltage-gated potassium channels (Isacoff et al.,
1990
; Krapivinsky et al., 1995
) associate their subunits
in various combinations to generate different channels, each with unique functional properties. In the present
study, we have examined whether the three subunits of
ENaC,
,
, and
, can also associate in various combinations to form channels with distinct functional
characteristics. The existence of a diversity of sodium
channels is suggested by reports describing amiloride-sensitive sodium channels with properties that do not
correspond to those of ENaC (Cantiello et al., 1989
;
MacGregor et al., 1994
; Yue et al., 1994
). For instance,
it has been shown that in fetal lung epithelial cells
there are two populations of amiloride-sensitive sodium
channels, one with high affinity (Ki = 0.019 µM) and
the other with low affinity (Ki = 1.5 µM) for benzamil
(Matalon et al., 1993
). Sodium-selective channels with
ILi+/INa+ current ratio <1 and relative low amiloride affinity (Ki = 0.87 mM) have been described in membranes of rat macrophages (Negulyaev and Vedernikova, 1994
). In the apical membrane of rabbit proximal tubules, amiloride-sensitive highly sodium-selective channels have been observed that have a larger single channel conductance than those present in the distal tubule
(Gögelein and Greger, 1986
).
These sodium-selective channels may be formed by
new subunit proteins from the ENaC family or by combinations of the already known ENaC subunits. Waldmann et al. (1995a)
have cloned a
subunit that can associate with
and
but not with
to form functional channels. The ILi+/INa+ ratio of
is <1, and the Ki for
amiloride is 2.6 µM. These properties are similar to
those of 
channels. The expression of the
subunit
overlaps with the expression of
,
, and
in several tissues including the kidney, although it is not yet known
which segments of the nephron express the
subunit
or whether there is colocalization with the other ENaC
subunits to form functional channels in vivo.
Recently, Farman and colleagues (1997) have reported heterogeneity at the level of expression of the
subunits of ENaC in respiratory epithelia. A large prevalence of
and
expression was found in a subpopulation of alveolar cells, in tracheal epithelium as well as in
nasal and tracheal gland acini, with little or no
subunit expression. In other tissues, such as the epithelium
of the distal colon, the level of expression of individual
subunits is highly regulated by aldosterone. Under normal conditions these cells only express the
subunit;
following stimulation by aldosterone, however, large
amounts of
and
cRNAs are expressed (Asher et al.,
1997
). Differential expression of ENaC subunits could
represent a mechanism of regulating Na+ reabsorption
in tissues. For instance, cells that express only
and
or
,
, and
subunits will form channels with high sodium affinity and high amiloride sensitivity, however
the maximal capacity for Na+ absorption in
and
cells will be much smaller than in cells that express simultaneously the three subunits (Canessa et al., 1994
).
The high affinity for external Na+ of 
and 

channels is important for efficient Na+ absorption in tissues
such as the cortical-collecting tubule of the kidney
where the luminal Na+ concentration reaches very low
levels in states of Na+ depletion. On the other hand,
cells that only express
and
subunits will form channels with low affinity for Na+, which will limit Na+ absorption unless the concentration of external Na+ is
large. Therefore, 
channels will only be active when
exposed to high Na+ concentrations such as in the lumen of proximal tubules, in the pulmonary airways, or
in surrounding macrophages (although the functional
significance of ENaC in blood cells is still unknown).
In summary, our results indicate that the ENaC subunits can indeed generate a diversity of channels with different functional and pharmacological characteristics. Epithelial Na+ channels like other multimeric channel proteins have the potential for complex regulation by differential expression of their subunits during development and under the influence of various hormones and stimuli.
Ki of Amiloride
The most specific inhibitor of Na+ channels in high- resistance epithelia is the potassium-sparing diuretic drug amiloride. Several observations indicate that this drug acts by obstructing the conducting pore: (a) it has been demonstrated that the positive charge on the guanidinium moiety is essential for blocking; (b) the Ki of amiloride is sensitive to the luminal Na+ activity indicating an amiloride-ion competition effect; and (c) the channel-amiloride association/dissociation rate constants are voltage dependent. These findings are consistent with the notion that amiloride blocks the channel from the outer part of the conducting pore. However, the molecular site(s) on the channel protein to which the blocker binds has not yet been defined.
We have shown that the amiloride affinity of 
channels is significantly lower than that exhibited by


and 
channels and have presented evidence that
a short stretch of 15 amino acids before the second
transmembrane domain of the
subunit determines the amiloride Ki of 
channels. In spite of a 25-fold
difference in amiloride and benzamil Ki of 
and 
,
both types of channels exhibited the same affinity for
guanidinium with a Ki of 15 mM. The results indicate
that the amiloride molecule interacts with the channel
protein in at least two distinct sites. At one site, guanidinium binds loosely to the outer pore of the channel.
At another distinct site, the pyrazine group binds, increasing the affinity of the blocker by several hundred-fold. Three key observations support the notion that
guanidinium binds to a similar site in 
and 
channels: (a) similar guanidinium Ki; (b) a similar electrical
distance (
) sensed by the charged moiety of amiloride; and (c) similar competitive effe